Mature sequence ssc-miR-342

Accession numberMIMAT0013944
IDssc-miR-342
Stem-Loop ssc-mir-342
Sequence
ucucacacagaaaucgcacccguca
Get sequence
Deep sequencing664 reads, 15 experiments

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).