Mature sequence hsa-miR-2909

Accession numberMIMAT0013863
IDhsa-miR-2909
Stem-Loop hsa-mir-2909
Sequence
guuagggccaacaucucuugg
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1
"Cellular AATF gene encodes a novel miRNA that can contribute to HIV-1 latency" Kaul D, Hussain A Indian J. Biochem. Biophys. 46:237-240(2009).
2
PMID:22504889 "Regulatory role of miR-2909 in cell-mediated immune response" Kaul D, Sasikala M, Raina A Cell Biochem Funct. 30:500-504(2012).