Mature sequence osa-miR2878-5p

Accession numberMIMAT0013828
IDosa-miR2878-5p
Stem-Loop osa-MIR2878
Sequence
uacauguauaaaauucugaggaug
Get sequence
Deep sequencing103 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).