Mature sequence osa-miR2865

Accession numberMIMAT0013812
IDosa-miR2865
Stem-Loop osa-MIR2865
Sequence
cucagcagucgacuguaccgug
Get sequence
Deep sequencing6 reads, 2 experiments

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).