Mature sequence ola-miR-430c

Accession numberMIMAT0013805
IDola-miR-430c
Stem-Loop ola-mir-430c-1 ola-mir-430c-2 ola-mir-430c-3 ola-mir-430c-4 ola-mir-430c-5 ola-mir-430c-6 ola-mir-430c-7
Sequence
uaagugcuacauguugggguag
Get sequence
Deep sequencing reads, experiments

References

1