Mature sequence bmo-miR-2856-5p

Accession numberMIMAT0013792
IDbmo-miR-2856-5p
Previous IDsbmo-miR-2856*
Stem-Loop bmo-mir-2856-1 bmo-mir-2856-2
Sequence
uugucugugguucgagggug
Get sequence
Deep sequencing6 reads, 2 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).