Mature sequence bmo-miR-2854

Accession numberMIMAT0013789
IDbmo-miR-2854
Stem-Loop bmo-mir-2854
Sequence
ucuuucaaaacugcaggacgg
Get sequence
Deep sequencing325 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).