Mature sequence bmo-miR-2828

Accession numberMIMAT0013740
IDbmo-miR-2828
Stem-Loop bmo-mir-2828
Sequence
auauucgauaugugaacgguu
Get sequence
Deep sequencing116 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).