Mature sequence bmo-miR-2820

Accession numberMIMAT0013730
IDbmo-miR-2820
Stem-Loop bmo-mir-2820-1 bmo-mir-2820-2
Sequence
cagcaagauggaacgugaaua
Get sequence
Deep sequencing47 reads, 3 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).