Mature sequence bmo-miR-2812

Accession numberMIMAT0013720
IDbmo-miR-2812
Stem-Loop bmo-mir-2812
Sequence
caggcuguaauagaaaggcu
Get sequence
Deep sequencing15 reads, 2 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).