Mature sequence bmo-miR-9d

Accession numberMIMAT0013620
IDbmo-miR-9d
Stem-Loop bmo-mir-9d
Sequence
auaaagcuaauucacugagugu
Get sequence
Deep sequencing12 reads, 2 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).