Mature sequence bmo-miR-279d-3p

Accession numberMIMAT0013607
IDbmo-miR-279d-3p
Previous IDsbmo-miR-279d
Stem-Loop bmo-mir-279d
Sequence
ugacuagauuuucacuuauccu
Get sequence
Deep sequencing611 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).