Mature sequence bmo-miR-998

Accession numberMIMAT0013603
IDbmo-miR-998
Sequence
uagcaccaugggauucagcu
Get sequence
Stem-Loop bmo-mir-998

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).