Mature sequence cte-miR-2709

Accession numberMIMAT0013578
IDcte-miR-2709
Stem-Loop cte-mir-2709
Sequence
uguuugaauuagcugugaugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).