Mature sequence cte-miR-210b

Accession numberMIMAT0013572
IDcte-miR-210b
Stem-Loop cte-mir-210b
Sequence
cugugcguaaaacagcgaccuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).