Mature sequence cte-miR-2696

Accession numberMIMAT0013557
IDcte-miR-2696
Stem-Loop cte-mir-2696
Sequence
uggguuuguaauguggucaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).