Mature sequence cte-miR-2688-5p

Accession numberMIMAT0013540
IDcte-miR-2688-5p
Previous IDscte-miR-2688*
Stem-Loop cte-mir-2688
Sequence
gcgcugguuuuacugaaguugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).