Mature sequence mtr-miR2653b

Accession numberMIMAT0013437
IDmtr-miR2653b
Stem-Loop mtr-MIR2653b
Sequence
ucacgcugcugugaacaugau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).