Mature sequence eca-miR-508-3p

Accession numberMIMAT0013232
IDeca-miR-508-3p
Stem-Loop eca-mir-508
Sequence
ugauugucaccuuuuggaguaga
Get sequence
Deep sequencing2561 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).