Mature sequence eca-miR-106a

Accession numberMIMAT0013194
IDeca-miR-106a
Stem-Loop eca-mir-106a
Sequence
caaagugcuuacagugcagguag
Get sequence
Deep sequencing1440 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).