Mature sequence eca-miR-215

Accession numberMIMAT0013190
IDeca-miR-215
Stem-Loop eca-mir-215
Sequence
augaccuaugaauugacagac
Get sequence
Deep sequencing667 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).