Mature sequence eca-miR-377

Accession numberMIMAT0013146
IDeca-miR-377
Stem-Loop eca-mir-377
Sequence
aucacacaaaggcaacuuuugu
Get sequence
Deep sequencing85 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).