Mature sequence eca-miR-299

Accession numberMIMAT0013130
IDeca-miR-299
Stem-Loop eca-mir-299
Sequence
uaugugggaugguaaaccgcuu
Get sequence
Deep sequencing411 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).