Mature sequence eca-miR-154a

Accession numberMIMAT0013129
IDeca-miR-154a
Previous IDseca-miR-154
Stem-Loop eca-mir-154a
Sequence
uagguuauccguguugccuucg
Get sequence
Deep sequencing39 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).