Mature sequence eca-miR-568

Accession numberMIMAT0013095
IDeca-miR-568
Stem-Loop eca-mir-568
Sequence
auguauaaauguauacacac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).