Mature sequence eca-miR-92a

Accession numberMIMAT0013089
IDeca-miR-92a
Stem-Loop eca-mir-92a eca-mir-92a-2
Sequence
uauugcacuugucccggccugu
Get sequence
Deep sequencing378363 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).