Mature sequence eca-miR-19b

Accession numberMIMAT0013087
IDeca-miR-19b
Stem-Loop eca-mir-19b eca-mir-19b-2
Sequence
ugugcaaauccaugcaaaacuga
Get sequence
Deep sequencing3930 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).