Mature sequence eca-miR-15a

Accession numberMIMAT0013083
IDeca-miR-15a
Stem-Loop eca-mir-15a
Sequence
uagcagcacauaaugguuugug
Get sequence
Deep sequencing1161 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).