Mature sequence eca-miR-711

Accession numberMIMAT0013080
IDeca-miR-711
Stem-Loop eca-mir-711
Sequence
gggacccagggagagacguaag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).