Mature sequence eca-miR-143

Accession numberMIMAT0013063
IDeca-miR-143
Stem-Loop eca-mir-143
Sequence
ugagaugaagcacuguagcuc
Get sequence
Deep sequencing1199461 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).