Mature sequence eca-miR-106b

Accession numberMIMAT0013054
IDeca-miR-106b
Stem-Loop eca-mir-106b
Sequence
uaaagugcugacagugcagau
Get sequence
Deep sequencing289 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).