Mature sequence eca-miR-125a-5p

Accession numberMIMAT0013008
IDeca-miR-125a-5p
Stem-Loop eca-mir-125a
Sequence
ucccugagacccuuuaaccuguga
Get sequence
Deep sequencing42777 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).