Mature sequence eca-miR-34b-5p

Accession numberMIMAT0012990
IDeca-miR-34b-5p
Stem-Loop eca-mir-34b
Sequence
aggcaguguaauuagcugauugu
Get sequence
Deep sequencing23388 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).