Mature sequence eca-miR-139-3p

Accession numberMIMAT0012984
IDeca-miR-139-3p
Stem-Loop eca-mir-139
Sequence
ggagacgcggcccuguuggagu
Get sequence
Deep sequencing7 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).