Mature sequence eca-miR-26a

Accession numberMIMAT0012975
IDeca-miR-26a
Stem-Loop eca-mir-26a eca-mir-26a-2
Sequence
uucaaguaauccaggauaggcu
Get sequence
Deep sequencing362274 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).