Mature sequence eca-miR-101

Accession numberMIMAT0012951
IDeca-miR-101
Stem-Loop eca-mir-101-1 eca-mir-101-2
Sequence
uacaguacugugauaacugaa
Get sequence
Deep sequencing19958 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).