Mature sequence eca-miR-653

Accession numberMIMAT0012947
IDeca-miR-653
Stem-Loop eca-mir-653
Sequence
guguugaaacaaucucugcug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).