Mature sequence eca-miR-148a

Accession numberMIMAT0012935
IDeca-miR-148a
Stem-Loop eca-mir-148a
Sequence
ucagugcacuacagaacuuugu
Get sequence
Deep sequencing86574 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).