Mature sequence eca-miR-761

Accession numberMIMAT0012923
IDeca-miR-761
Stem-Loop eca-mir-761
Sequence
gcagcagggugaaacugacaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).