Mature sequence eca-miR-200a

Accession numberMIMAT0012909
IDeca-miR-200a
Stem-Loop eca-mir-200a
Sequence
uaacacugucugguaacgaugu
Get sequence
Deep sequencing33 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).