Mature sequence eca-miR-146b-3p

Accession numberMIMAT0012892
IDeca-miR-146b-3p
Stem-Loop eca-mir-146b
Sequence
ugcccuagggacucaguucugg
Get sequence
Deep sequencing15 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).