Mature sequence rno-miR-504

Accession numberMIMAT0012830
IDrno-miR-504
Stem-Loop rno-mir-504
Sequence
agacccuggucugcacucuguc
Get sequence
Deep sequencing50074 reads, 428 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).