Mature sequence rno-miR-490-3p

Accession numberMIMAT0012823
IDrno-miR-490-3p
Previous IDsrno-miR-490
Stem-Loop rno-mir-490
Sequence
caaccuggaggacuccaugcug
Get sequence
Deep sequencing88559 reads, 420 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).