Mature sequence mml-miR-603

Accession numberMIMAT0012781
IDmml-miR-603
Stem-Loop mml-mir-603
Sequence
cacacacugcaauuacuuuuuc
Get sequence
Deep sequencing9 reads, 4 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).