Mature sequence mdo-miR-195

Accession numberMIMAT0012760
IDmdo-miR-195
Stem-Loop mdo-mir-195
Sequence
uagcagcacaaaaauauuggca
Get sequence
Deep sequencing2826 reads, 5 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).