Mature sequence mdo-miR-215

Accession numberMIMAT0012751
IDmdo-miR-215
Stem-Loop mdo-mir-215
Sequence
augaccuaugaauugacagaca
Get sequence
Deep sequencing661117 reads, 5 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).