Mature sequence mdo-miR-146a-5p

Accession numberMIMAT0012746
IDmdo-miR-146a-5p
Stem-Loop mdo-mir-146a
Sequence
ugagaacugaauuccauggguu
Get sequence
Deep sequencing135781 reads, 5 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).