Mature sequence iltv-miR-I1-3p

Accession numberMIMAT0012724
IDiltv-miR-I1-3p
Previous IDsiltv-miR-I1*
Stem-Loop iltv-mir-I1
Sequence
aauuccauuccucuuucugucucc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).
2
PMID:19728068 "Identification and expression analysis of infectious laryngotracheitis virus encoding microRNAs" Rachamadugu R, Lee JY, Wooming A, Kong BW Virus Genes. 39:301-308(2009).