Mature sequence isc-miR-317

Accession numberMIMAT0012699
IDisc-miR-317
Stem-Loop isc-mir-317
Sequence
ugaacacagcuggugguauaucagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).