Mature sequence bmo-miR-989a

Accession numberMIMAT0012633
IDbmo-miR-989a
Previous IDsbmo-miR-989
Sequence
gugugaugugacguaguggaa
Get sequence
Stem-Loop bmo-mir-989a

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:19823945 "Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)" Huang Y, Zou Q, Tang SM, Wang LG, Shen XJ Mol Biol Rep. 37:3171-3176(2010).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).